ID: 1012765499

View in Genome Browser
Species Human (GRCh38)
Location 6:103362467-103362489
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012765496_1012765499 4 Left 1012765496 6:103362440-103362462 CCTAGAAACTTGTTGAATAGTTT No data
Right 1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012765499 Original CRISPR CAAAATGCTCATAGTGATAT GGG Intergenic