ID: 1012769116

View in Genome Browser
Species Human (GRCh38)
Location 6:103405698-103405720
Sequence AGAGGGAAGGGTCAGACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012769116_1012769125 21 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769125 6:103405742-103405764 AGGGCAAACTTGAACTGCAAGGG No data
1012769116_1012769128 29 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769116_1012769123 2 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769123 6:103405723-103405745 TTTGCTAGAATTTTGTCAAAGGG No data
1012769116_1012769127 28 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769127 6:103405749-103405771 ACTTGAACTGCAAGGGGAACTGG No data
1012769116_1012769124 20 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769124 6:103405741-103405763 AAGGGCAAACTTGAACTGCAAGG No data
1012769116_1012769126 22 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769126 6:103405743-103405765 GGGCAAACTTGAACTGCAAGGGG No data
1012769116_1012769122 1 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769122 6:103405722-103405744 CTTTGCTAGAATTTTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012769116 Original CRISPR AGAGGGAAGGGTCAGACTCA TGG (reversed) Intergenic
No off target data available for this crispr