ID: 1012769118

View in Genome Browser
Species Human (GRCh38)
Location 6:103405711-103405733
Sequence ATTCTAGCAAAGGAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012769118_1012769128 16 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769118_1012769127 15 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769127 6:103405749-103405771 ACTTGAACTGCAAGGGGAACTGG No data
1012769118_1012769125 8 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769125 6:103405742-103405764 AGGGCAAACTTGAACTGCAAGGG No data
1012769118_1012769126 9 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769126 6:103405743-103405765 GGGCAAACTTGAACTGCAAGGGG No data
1012769118_1012769129 24 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769129 6:103405758-103405780 GCAAGGGGAACTGGGAAAACAGG No data
1012769118_1012769124 7 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769124 6:103405741-103405763 AAGGGCAAACTTGAACTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012769118 Original CRISPR ATTCTAGCAAAGGAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr