ID: 1012769122

View in Genome Browser
Species Human (GRCh38)
Location 6:103405722-103405744
Sequence CTTTGCTAGAATTTTGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012769116_1012769122 1 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769122 6:103405722-103405744 CTTTGCTAGAATTTTGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012769122 Original CRISPR CTTTGCTAGAATTTTGTCAA AGG Intergenic
No off target data available for this crispr