ID: 1012769123

View in Genome Browser
Species Human (GRCh38)
Location 6:103405723-103405745
Sequence TTTGCTAGAATTTTGTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012769117_1012769123 -10 Left 1012769117 6:103405710-103405732 CCCTTCCCTCTCCTTTGCTAGAA No data
Right 1012769123 6:103405723-103405745 TTTGCTAGAATTTTGTCAAAGGG No data
1012769116_1012769123 2 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769123 6:103405723-103405745 TTTGCTAGAATTTTGTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012769123 Original CRISPR TTTGCTAGAATTTTGTCAAA GGG Intergenic
No off target data available for this crispr