ID: 1012769128

View in Genome Browser
Species Human (GRCh38)
Location 6:103405750-103405772
Sequence CTTGAACTGCAAGGGGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012769116_1012769128 29 Left 1012769116 6:103405698-103405720 CCATGAGTCTGACCCTTCCCTCT No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769121_1012769128 6 Left 1012769121 6:103405721-103405743 CCTTTGCTAGAATTTTGTCAAAG No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769118_1012769128 16 Left 1012769118 6:103405711-103405733 CCTTCCCTCTCCTTTGCTAGAAT No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769117_1012769128 17 Left 1012769117 6:103405710-103405732 CCCTTCCCTCTCCTTTGCTAGAA No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769119_1012769128 12 Left 1012769119 6:103405715-103405737 CCCTCTCCTTTGCTAGAATTTTG No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data
1012769120_1012769128 11 Left 1012769120 6:103405716-103405738 CCTCTCCTTTGCTAGAATTTTGT No data
Right 1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012769128 Original CRISPR CTTGAACTGCAAGGGGAACT GGG Intergenic
No off target data available for this crispr