ID: 1012774045

View in Genome Browser
Species Human (GRCh38)
Location 6:103480252-103480274
Sequence CCTCATATGCAGAAGGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012774038_1012774045 -6 Left 1012774038 6:103480235-103480257 CCCTCCGTGATATTGTTCCTCAT No data
Right 1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG No data
1012774040_1012774045 -10 Left 1012774040 6:103480239-103480261 CCGTGATATTGTTCCTCATATGC No data
Right 1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG No data
1012774037_1012774045 -5 Left 1012774037 6:103480234-103480256 CCCCTCCGTGATATTGTTCCTCA No data
Right 1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG No data
1012774039_1012774045 -7 Left 1012774039 6:103480236-103480258 CCTCCGTGATATTGTTCCTCATA No data
Right 1012774045 6:103480252-103480274 CCTCATATGCAGAAGGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012774045 Original CRISPR CCTCATATGCAGAAGGGGAG AGG Intergenic
No off target data available for this crispr