ID: 1012774055

View in Genome Browser
Species Human (GRCh38)
Location 6:103480329-103480351
Sequence TATAATATCCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012774051_1012774055 -5 Left 1012774051 6:103480311-103480333 CCTCTCTGTGATATTGGTTATAA No data
Right 1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG No data
1012774048_1012774055 20 Left 1012774048 6:103480286-103480308 CCCAATATCTCAGGTGGTCTACA No data
Right 1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG No data
1012774049_1012774055 19 Left 1012774049 6:103480287-103480309 CCAATATCTCAGGTGGTCTACAC No data
Right 1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012774055 Original CRISPR TATAATATCCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr