ID: 1012777444

View in Genome Browser
Species Human (GRCh38)
Location 6:103515902-103515924
Sequence ATCAAATAGAAAAGGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012777444_1012777452 15 Left 1012777444 6:103515902-103515924 CCATGGATCCTTTTCTATTTGAT No data
Right 1012777452 6:103515940-103515962 TTTAACAAACTAAAATTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012777444 Original CRISPR ATCAAATAGAAAAGGATCCA TGG (reversed) Intergenic
No off target data available for this crispr