ID: 1012780090

View in Genome Browser
Species Human (GRCh38)
Location 6:103546801-103546823
Sequence CCAATACCACCAAGCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012780084_1012780090 13 Left 1012780084 6:103546765-103546787 CCAAACCTCAACTCTTGCCTTCT 0: 48
1: 162
2: 1531
3: 2045
4: 1815
Right 1012780090 6:103546801-103546823 CCAATACCACCAAGCCACCAAGG No data
1012780087_1012780090 -4 Left 1012780087 6:103546782-103546804 CCTTCTGCACACTGCAGGCCCAA No data
Right 1012780090 6:103546801-103546823 CCAATACCACCAAGCCACCAAGG No data
1012780085_1012780090 8 Left 1012780085 6:103546770-103546792 CCTCAACTCTTGCCTTCTGCACA 0: 26
1: 87
2: 205
3: 431
4: 1942
Right 1012780090 6:103546801-103546823 CCAATACCACCAAGCCACCAAGG No data
1012780083_1012780090 14 Left 1012780083 6:103546764-103546786 CCCAAACCTCAACTCTTGCCTTC 0: 47
1: 161
2: 1463
3: 1916
4: 1671
Right 1012780090 6:103546801-103546823 CCAATACCACCAAGCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012780090 Original CRISPR CCAATACCACCAAGCCACCA AGG Intergenic
No off target data available for this crispr