ID: 1012788426 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:103660672-103660694 |
Sequence | TGGGGTTCTGCTGTGTTATT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012788426_1012788432 | -2 | Left | 1012788426 | 6:103660672-103660694 | CCTAATAACACAGCAGAACCCCA | No data | ||
Right | 1012788432 | 6:103660693-103660715 | CATTTCCGCTGGGAGTGAAATGG | No data | ||||
1012788426_1012788434 | 21 | Left | 1012788426 | 6:103660672-103660694 | CCTAATAACACAGCAGAACCCCA | No data | ||
Right | 1012788434 | 6:103660716-103660738 | TATCTCCCGCATGCTGCACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012788426 | Original CRISPR | TGGGGTTCTGCTGTGTTATT AGG (reversed) | Intergenic | ||