ID: 1012788426

View in Genome Browser
Species Human (GRCh38)
Location 6:103660672-103660694
Sequence TGGGGTTCTGCTGTGTTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012788426_1012788432 -2 Left 1012788426 6:103660672-103660694 CCTAATAACACAGCAGAACCCCA No data
Right 1012788432 6:103660693-103660715 CATTTCCGCTGGGAGTGAAATGG No data
1012788426_1012788434 21 Left 1012788426 6:103660672-103660694 CCTAATAACACAGCAGAACCCCA No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012788426 Original CRISPR TGGGGTTCTGCTGTGTTATT AGG (reversed) Intergenic
No off target data available for this crispr