ID: 1012788429

View in Genome Browser
Species Human (GRCh38)
Location 6:103660690-103660712
Sequence TTTCACTCCCAGCGGAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012788429_1012788434 3 Left 1012788429 6:103660690-103660712 CCCCATTTCCGCTGGGAGTGAAA No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788429_1012788437 17 Left 1012788429 6:103660690-103660712 CCCCATTTCCGCTGGGAGTGAAA No data
Right 1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012788429 Original CRISPR TTTCACTCCCAGCGGAAATG GGG (reversed) Intergenic
No off target data available for this crispr