ID: 1012788430

View in Genome Browser
Species Human (GRCh38)
Location 6:103660691-103660713
Sequence ATTTCACTCCCAGCGGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012788430_1012788434 2 Left 1012788430 6:103660691-103660713 CCCATTTCCGCTGGGAGTGAAAT No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788430_1012788437 16 Left 1012788430 6:103660691-103660713 CCCATTTCCGCTGGGAGTGAAAT No data
Right 1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012788430 Original CRISPR ATTTCACTCCCAGCGGAAAT GGG (reversed) Intergenic
No off target data available for this crispr