ID: 1012788431 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:103660692-103660714 |
| Sequence | CATTTCACTCCCAGCGGAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012788431_1012788434 | 1 | Left | 1012788431 | 6:103660692-103660714 | CCATTTCCGCTGGGAGTGAAATG | No data | ||
| Right | 1012788434 | 6:103660716-103660738 | TATCTCCCGCATGCTGCACACGG | No data | ||||
| 1012788431_1012788437 | 15 | Left | 1012788431 | 6:103660692-103660714 | CCATTTCCGCTGGGAGTGAAATG | No data | ||
| Right | 1012788437 | 6:103660730-103660752 | TGCACACGGAAGCTCCACGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012788431 | Original CRISPR | CATTTCACTCCCAGCGGAAA TGG (reversed) | Intergenic | ||