ID: 1012788431 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:103660692-103660714 |
Sequence | CATTTCACTCCCAGCGGAAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1012788431_1012788437 | 15 | Left | 1012788431 | 6:103660692-103660714 | CCATTTCCGCTGGGAGTGAAATG | No data | ||
Right | 1012788437 | 6:103660730-103660752 | TGCACACGGAAGCTCCACGTAGG | No data | ||||
1012788431_1012788434 | 1 | Left | 1012788431 | 6:103660692-103660714 | CCATTTCCGCTGGGAGTGAAATG | No data | ||
Right | 1012788434 | 6:103660716-103660738 | TATCTCCCGCATGCTGCACACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1012788431 | Original CRISPR | CATTTCACTCCCAGCGGAAA TGG (reversed) | Intergenic | ||