ID: 1012788432

View in Genome Browser
Species Human (GRCh38)
Location 6:103660693-103660715
Sequence CATTTCCGCTGGGAGTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012788425_1012788432 -1 Left 1012788425 6:103660671-103660693 CCCTAATAACACAGCAGAACCCC No data
Right 1012788432 6:103660693-103660715 CATTTCCGCTGGGAGTGAAATGG No data
1012788426_1012788432 -2 Left 1012788426 6:103660672-103660694 CCTAATAACACAGCAGAACCCCA No data
Right 1012788432 6:103660693-103660715 CATTTCCGCTGGGAGTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012788432 Original CRISPR CATTTCCGCTGGGAGTGAAA TGG Intergenic
No off target data available for this crispr