ID: 1012788434

View in Genome Browser
Species Human (GRCh38)
Location 6:103660716-103660738
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012788426_1012788434 21 Left 1012788426 6:103660672-103660694 CCTAATAACACAGCAGAACCCCA No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788433_1012788434 -5 Left 1012788433 6:103660698-103660720 CCGCTGGGAGTGAAATGGTATCT No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788430_1012788434 2 Left 1012788430 6:103660691-103660713 CCCATTTCCGCTGGGAGTGAAAT No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788425_1012788434 22 Left 1012788425 6:103660671-103660693 CCCTAATAACACAGCAGAACCCC No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788431_1012788434 1 Left 1012788431 6:103660692-103660714 CCATTTCCGCTGGGAGTGAAATG No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data
1012788429_1012788434 3 Left 1012788429 6:103660690-103660712 CCCCATTTCCGCTGGGAGTGAAA No data
Right 1012788434 6:103660716-103660738 TATCTCCCGCATGCTGCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012788434 Original CRISPR TATCTCCCGCATGCTGCACA CGG Intergenic