ID: 1012788437

View in Genome Browser
Species Human (GRCh38)
Location 6:103660730-103660752
Sequence TGCACACGGAAGCTCCACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012788429_1012788437 17 Left 1012788429 6:103660690-103660712 CCCCATTTCCGCTGGGAGTGAAA No data
Right 1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG No data
1012788430_1012788437 16 Left 1012788430 6:103660691-103660713 CCCATTTCCGCTGGGAGTGAAAT No data
Right 1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG No data
1012788433_1012788437 9 Left 1012788433 6:103660698-103660720 CCGCTGGGAGTGAAATGGTATCT No data
Right 1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG No data
1012788431_1012788437 15 Left 1012788431 6:103660692-103660714 CCATTTCCGCTGGGAGTGAAATG No data
Right 1012788437 6:103660730-103660752 TGCACACGGAAGCTCCACGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012788437 Original CRISPR TGCACACGGAAGCTCCACGT AGG Intergenic
No off target data available for this crispr