ID: 1012791337

View in Genome Browser
Species Human (GRCh38)
Location 6:103701236-103701258
Sequence CCACATGTTTAGTCTCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012791326_1012791337 25 Left 1012791326 6:103701188-103701210 CCTCAAAAAGTAAAACCCCAGAT No data
Right 1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG No data
1012791329_1012791337 10 Left 1012791329 6:103701203-103701225 CCCCAGATTTTTTCAGTTGGGAA No data
Right 1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG No data
1012791331_1012791337 8 Left 1012791331 6:103701205-103701227 CCAGATTTTTTCAGTTGGGAACA No data
Right 1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG No data
1012791330_1012791337 9 Left 1012791330 6:103701204-103701226 CCCAGATTTTTTCAGTTGGGAAC No data
Right 1012791337 6:103701236-103701258 CCACATGTTTAGTCTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012791337 Original CRISPR CCACATGTTTAGTCTCTGCA TGG Intergenic
No off target data available for this crispr