ID: 1012793665

View in Genome Browser
Species Human (GRCh38)
Location 6:103733942-103733964
Sequence TCCTCTGGCTGCCCTCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012793665_1012793672 4 Left 1012793665 6:103733942-103733964 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1012793672 6:103733969-103733991 GGGTTAAAATTCCACAGGGAAGG No data
1012793665_1012793671 0 Left 1012793665 6:103733942-103733964 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1012793671 6:103733965-103733987 GCAGGGGTTAAAATTCCACAGGG No data
1012793665_1012793670 -1 Left 1012793665 6:103733942-103733964 CCATCAGGAGGGCAGCCAGAGGA No data
Right 1012793670 6:103733964-103733986 AGCAGGGGTTAAAATTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012793665 Original CRISPR TCCTCTGGCTGCCCTCCTGA TGG (reversed) Intergenic