ID: 1012799815

View in Genome Browser
Species Human (GRCh38)
Location 6:103811386-103811408
Sequence GGTCATATCTACTTGCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012799815_1012799821 5 Left 1012799815 6:103811386-103811408 CCCCCTTGCAAGTAGATATGACC No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799815_1012799823 8 Left 1012799815 6:103811386-103811408 CCCCCTTGCAAGTAGATATGACC No data
Right 1012799823 6:103811417-103811439 AATTTCTCAAAAATGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012799815 Original CRISPR GGTCATATCTACTTGCAAGG GGG (reversed) Intergenic
No off target data available for this crispr