ID: 1012799816

View in Genome Browser
Species Human (GRCh38)
Location 6:103811387-103811409
Sequence TGGTCATATCTACTTGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012799816_1012799821 4 Left 1012799816 6:103811387-103811409 CCCCTTGCAAGTAGATATGACCA No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799816_1012799823 7 Left 1012799816 6:103811387-103811409 CCCCTTGCAAGTAGATATGACCA No data
Right 1012799823 6:103811417-103811439 AATTTCTCAAAAATGAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012799816 Original CRISPR TGGTCATATCTACTTGCAAG GGG (reversed) Intergenic
No off target data available for this crispr