ID: 1012799818

View in Genome Browser
Species Human (GRCh38)
Location 6:103811389-103811411
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012799818_1012799823 5 Left 1012799818 6:103811389-103811411 CCTTGCAAGTAGATATGACCAAG No data
Right 1012799823 6:103811417-103811439 AATTTCTCAAAAATGAATGGTGG No data
1012799818_1012799821 2 Left 1012799818 6:103811389-103811411 CCTTGCAAGTAGATATGACCAAG No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012799818 Original CRISPR CTTGGTCATATCTACTTGCA AGG (reversed) Intergenic
No off target data available for this crispr