ID: 1012799821

View in Genome Browser
Species Human (GRCh38)
Location 6:103811414-103811436
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012799818_1012799821 2 Left 1012799818 6:103811389-103811411 CCTTGCAAGTAGATATGACCAAG No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799816_1012799821 4 Left 1012799816 6:103811387-103811409 CCCCTTGCAAGTAGATATGACCA No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799814_1012799821 10 Left 1012799814 6:103811381-103811403 CCAGGCCCCCTTGCAAGTAGATA No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799817_1012799821 3 Left 1012799817 6:103811388-103811410 CCCTTGCAAGTAGATATGACCAA No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799815_1012799821 5 Left 1012799815 6:103811386-103811408 CCCCCTTGCAAGTAGATATGACC No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799811_1012799821 30 Left 1012799811 6:103811361-103811383 CCAGCTGGAAACCTTATTTTCCA No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data
1012799813_1012799821 19 Left 1012799813 6:103811372-103811394 CCTTATTTTCCAGGCCCCCTTGC No data
Right 1012799821 6:103811414-103811436 GCCAATTTCTCAAAAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012799821 Original CRISPR GCCAATTTCTCAAAAATGAA TGG Intergenic