ID: 1012801733

View in Genome Browser
Species Human (GRCh38)
Location 6:103838563-103838585
Sequence CACAGCACAGTGTAGCGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012801733_1012801735 -5 Left 1012801733 6:103838563-103838585 CCAGTCCGCTACACTGTGCTGTG No data
Right 1012801735 6:103838581-103838603 CTGTGCTGACGTAACTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012801733 Original CRISPR CACAGCACAGTGTAGCGGAC TGG (reversed) Intergenic
No off target data available for this crispr