ID: 1012805330

View in Genome Browser
Species Human (GRCh38)
Location 6:103886067-103886089
Sequence GATTCTACCTCCAGTGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012805330_1012805333 3 Left 1012805330 6:103886067-103886089 CCAAATCCACTGGAGGTAGAATC No data
Right 1012805333 6:103886093-103886115 CTCATATCTGTTGAGCATCAAGG No data
1012805330_1012805334 4 Left 1012805330 6:103886067-103886089 CCAAATCCACTGGAGGTAGAATC No data
Right 1012805334 6:103886094-103886116 TCATATCTGTTGAGCATCAAGGG No data
1012805330_1012805335 8 Left 1012805330 6:103886067-103886089 CCAAATCCACTGGAGGTAGAATC No data
Right 1012805335 6:103886098-103886120 ATCTGTTGAGCATCAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012805330 Original CRISPR GATTCTACCTCCAGTGGATT TGG (reversed) Intergenic
No off target data available for this crispr