ID: 1012806635

View in Genome Browser
Species Human (GRCh38)
Location 6:103903108-103903130
Sequence CTGGAGGCACAAATGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012806631_1012806635 -6 Left 1012806631 6:103903091-103903113 CCAGGCCGGGTTCTCACCTGGAG No data
Right 1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012806635 Original CRISPR CTGGAGGCACAAATGAAGAA AGG Intergenic
No off target data available for this crispr