ID: 1012811995

View in Genome Browser
Species Human (GRCh38)
Location 6:103970732-103970754
Sequence CTGGCTATTTGGGCTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012811995_1012812000 10 Left 1012811995 6:103970732-103970754 CCAAAAAAAGCCCAAATAGCCAG No data
Right 1012812000 6:103970765-103970787 AGCAAAAAAAGCAAAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012811995 Original CRISPR CTGGCTATTTGGGCTTTTTT TGG (reversed) Intergenic
No off target data available for this crispr