ID: 1012820296

View in Genome Browser
Species Human (GRCh38)
Location 6:104078416-104078438
Sequence TCCCTATGTGCTGGGAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012820285_1012820296 27 Left 1012820285 6:104078366-104078388 CCAGACTGGTCTCAAACTCTTGG 0: 64
1: 2701
2: 29350
3: 99054
4: 168362
Right 1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG No data
1012820288_1012820296 -10 Left 1012820288 6:104078403-104078425 CCCACCCTAACCCTCCCTATGTG No data
Right 1012820296 6:104078416-104078438 TCCCTATGTGCTGGGAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012820296 Original CRISPR TCCCTATGTGCTGGGAGTAC AGG Intergenic
No off target data available for this crispr