ID: 1012820805

View in Genome Browser
Species Human (GRCh38)
Location 6:104082928-104082950
Sequence AACAGTTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012820800_1012820805 15 Left 1012820800 6:104082890-104082912 CCGGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 1012820805 6:104082928-104082950 AACAGTTCTTGGCCTGTTACTGG No data
1012820799_1012820805 16 Left 1012820799 6:104082889-104082911 CCCGGCCATCTTCTGCAGATAAC No data
Right 1012820805 6:104082928-104082950 AACAGTTCTTGGCCTGTTACTGG No data
1012820801_1012820805 11 Left 1012820801 6:104082894-104082916 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1012820805 6:104082928-104082950 AACAGTTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012820805 Original CRISPR AACAGTTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr