ID: 1012821006

View in Genome Browser
Species Human (GRCh38)
Location 6:104084423-104084445
Sequence AGCCTGTTGATTTAAGGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012821006_1012821013 4 Left 1012821006 6:104084423-104084445 CCCCTACCTTAAATCAACAGGCT No data
Right 1012821013 6:104084450-104084472 AGGGAGTTACAGTGTTGACTGGG 0: 14
1: 171
2: 228
3: 164
4: 367
1012821006_1012821012 3 Left 1012821006 6:104084423-104084445 CCCCTACCTTAAATCAACAGGCT No data
Right 1012821012 6:104084449-104084471 AAGGGAGTTACAGTGTTGACTGG 0: 17
1: 174
2: 218
3: 161
4: 247
1012821006_1012821014 5 Left 1012821006 6:104084423-104084445 CCCCTACCTTAAATCAACAGGCT No data
Right 1012821014 6:104084451-104084473 GGGAGTTACAGTGTTGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012821006 Original CRISPR AGCCTGTTGATTTAAGGTAG GGG (reversed) Intergenic
No off target data available for this crispr