ID: 1012823142

View in Genome Browser
Species Human (GRCh38)
Location 6:104114154-104114176
Sequence ATGGAAACTCAGAATGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012823142_1012823148 16 Left 1012823142 6:104114154-104114176 CCCTCATCATTCTGAGTTTCCAT No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012823142 Original CRISPR ATGGAAACTCAGAATGATGA GGG (reversed) Intergenic
No off target data available for this crispr