ID: 1012823148

View in Genome Browser
Species Human (GRCh38)
Location 6:104114193-104114215
Sequence TGAATCAGAAAATCTCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012823142_1012823148 16 Left 1012823142 6:104114154-104114176 CCCTCATCATTCTGAGTTTCCAT No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823143_1012823148 15 Left 1012823143 6:104114155-104114177 CCTCATCATTCTGAGTTTCCATT No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823146_1012823148 -8 Left 1012823146 6:104114178-104114200 CCCATTCAGGTTTTCTGAATCAG No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823147_1012823148 -9 Left 1012823147 6:104114179-104114201 CCATTCAGGTTTTCTGAATCAGA No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823138_1012823148 27 Left 1012823138 6:104114143-104114165 CCCCTCTCAACCCCTCATCATTC No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823139_1012823148 26 Left 1012823139 6:104114144-104114166 CCCTCTCAACCCCTCATCATTCT No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823145_1012823148 -3 Left 1012823145 6:104114173-104114195 CCATTCCCATTCAGGTTTTCTGA No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823141_1012823148 17 Left 1012823141 6:104114153-104114175 CCCCTCATCATTCTGAGTTTCCA No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data
1012823140_1012823148 25 Left 1012823140 6:104114145-104114167 CCTCTCAACCCCTCATCATTCTG No data
Right 1012823148 6:104114193-104114215 TGAATCAGAAAATCTCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012823148 Original CRISPR TGAATCAGAAAATCTCAGAT TGG Intergenic
No off target data available for this crispr