ID: 1012826006

View in Genome Browser
Species Human (GRCh38)
Location 6:104147707-104147729
Sequence AAGTAGTTAAGGAGCTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012826001_1012826006 18 Left 1012826001 6:104147666-104147688 CCAATTACTAAATAAAATCTGTT No data
Right 1012826006 6:104147707-104147729 AAGTAGTTAAGGAGCTGAGCAGG No data
1012825998_1012826006 28 Left 1012825998 6:104147656-104147678 CCCCAAGGGGCCAATTACTAAAT No data
Right 1012826006 6:104147707-104147729 AAGTAGTTAAGGAGCTGAGCAGG No data
1012825999_1012826006 27 Left 1012825999 6:104147657-104147679 CCCAAGGGGCCAATTACTAAATA No data
Right 1012826006 6:104147707-104147729 AAGTAGTTAAGGAGCTGAGCAGG No data
1012826000_1012826006 26 Left 1012826000 6:104147658-104147680 CCAAGGGGCCAATTACTAAATAA No data
Right 1012826006 6:104147707-104147729 AAGTAGTTAAGGAGCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012826006 Original CRISPR AAGTAGTTAAGGAGCTGAGC AGG Intergenic
No off target data available for this crispr