ID: 1012826480

View in Genome Browser
Species Human (GRCh38)
Location 6:104152536-104152558
Sequence CTCTTTTTGTTACCAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012826480_1012826483 11 Left 1012826480 6:104152536-104152558 CCTGAAACTGGTAACAAAAAGAG No data
Right 1012826483 6:104152570-104152592 CTTACTGTTCCACATGGCTGTGG 0: 24
1: 1897
2: 5901
3: 7215
4: 7496
1012826480_1012826482 5 Left 1012826480 6:104152536-104152558 CCTGAAACTGGTAACAAAAAGAG No data
Right 1012826482 6:104152564-104152586 ATTAGACTTACTGTTCCACATGG No data
1012826480_1012826486 28 Left 1012826480 6:104152536-104152558 CCTGAAACTGGTAACAAAAAGAG No data
Right 1012826486 6:104152587-104152609 CTGTGGAGGCTTCAGAATCATGG No data
1012826480_1012826484 14 Left 1012826480 6:104152536-104152558 CCTGAAACTGGTAACAAAAAGAG No data
Right 1012826484 6:104152573-104152595 ACTGTTCCACATGGCTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012826480 Original CRISPR CTCTTTTTGTTACCAGTTTC AGG (reversed) Intergenic
No off target data available for this crispr