ID: 1012827024

View in Genome Browser
Species Human (GRCh38)
Location 6:104159248-104159270
Sequence CTTTGGGTAGGGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012827011_1012827024 25 Left 1012827011 6:104159200-104159222 CCCTGTAGTGTGCCTCATGGAGG No data
Right 1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG No data
1012827009_1012827024 28 Left 1012827009 6:104159197-104159219 CCACCCTGTAGTGTGCCTCATGG No data
Right 1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG No data
1012827013_1012827024 24 Left 1012827013 6:104159201-104159223 CCTGTAGTGTGCCTCATGGAGGA No data
Right 1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG No data
1012827014_1012827024 13 Left 1012827014 6:104159212-104159234 CCTCATGGAGGAAACACAGCAGG No data
Right 1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012827024 Original CRISPR CTTTGGGTAGGGAGGGTAGA GGG Intergenic
No off target data available for this crispr