ID: 1012840636

View in Genome Browser
Species Human (GRCh38)
Location 6:104324994-104325016
Sequence ATGTAGAAACAGCCTCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012840636_1012840641 5 Left 1012840636 6:104324994-104325016 CCATCCAGAGGCTGTTTCTACAT No data
Right 1012840641 6:104325022-104325044 ACTAATTCCAGGGAGAAAGAAGG No data
1012840636_1012840638 -6 Left 1012840636 6:104324994-104325016 CCATCCAGAGGCTGTTTCTACAT No data
Right 1012840638 6:104325011-104325033 CTACATCCAGAACTAATTCCAGG No data
1012840636_1012840639 -5 Left 1012840636 6:104324994-104325016 CCATCCAGAGGCTGTTTCTACAT No data
Right 1012840639 6:104325012-104325034 TACATCCAGAACTAATTCCAGGG No data
1012840636_1012840642 6 Left 1012840636 6:104324994-104325016 CCATCCAGAGGCTGTTTCTACAT No data
Right 1012840642 6:104325023-104325045 CTAATTCCAGGGAGAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012840636 Original CRISPR ATGTAGAAACAGCCTCTGGA TGG (reversed) Intergenic
No off target data available for this crispr