ID: 1012841876

View in Genome Browser
Species Human (GRCh38)
Location 6:104339279-104339301
Sequence GGTGATGGACAGAGGCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012841876_1012841881 -6 Left 1012841876 6:104339279-104339301 CCTCCAGGCCTCTGTCCATCACC No data
Right 1012841881 6:104339296-104339318 ATCACCTCACTTAACCCTGAGGG No data
1012841876_1012841887 27 Left 1012841876 6:104339279-104339301 CCTCCAGGCCTCTGTCCATCACC No data
Right 1012841887 6:104339329-104339351 ATCTGGCTAGTGAATTTAGTAGG No data
1012841876_1012841886 10 Left 1012841876 6:104339279-104339301 CCTCCAGGCCTCTGTCCATCACC No data
Right 1012841886 6:104339312-104339334 CTGAGGGTGAATGGCATATCTGG No data
1012841876_1012841880 -7 Left 1012841876 6:104339279-104339301 CCTCCAGGCCTCTGTCCATCACC No data
Right 1012841880 6:104339295-104339317 CATCACCTCACTTAACCCTGAGG No data
1012841876_1012841883 1 Left 1012841876 6:104339279-104339301 CCTCCAGGCCTCTGTCCATCACC No data
Right 1012841883 6:104339303-104339325 CACTTAACCCTGAGGGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012841876 Original CRISPR GGTGATGGACAGAGGCCTGG AGG (reversed) Intergenic
No off target data available for this crispr