ID: 1012845570

View in Genome Browser
Species Human (GRCh38)
Location 6:104383269-104383291
Sequence CAGGACAAAAAATTCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012845570_1012845573 -2 Left 1012845570 6:104383269-104383291 CCAACCAAGAATTTTTTGTCCTG No data
Right 1012845573 6:104383290-104383312 TGTCAAACTAAACTTCACAAAGG No data
1012845570_1012845574 2 Left 1012845570 6:104383269-104383291 CCAACCAAGAATTTTTTGTCCTG No data
Right 1012845574 6:104383294-104383316 AAACTAAACTTCACAAAGGAAGG No data
1012845570_1012845575 12 Left 1012845570 6:104383269-104383291 CCAACCAAGAATTTTTTGTCCTG No data
Right 1012845575 6:104383304-104383326 TCACAAAGGAAGGAGAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012845570 Original CRISPR CAGGACAAAAAATTCTTGGT TGG (reversed) Intergenic
No off target data available for this crispr