ID: 1012846030

View in Genome Browser
Species Human (GRCh38)
Location 6:104390003-104390025
Sequence GTTTTTTAGTGGATTCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012846030_1012846035 23 Left 1012846030 6:104390003-104390025 CCCTACAGAATCCACTAAAAAAC No data
Right 1012846035 6:104390049-104390071 AGTAAAGTTACAGGATACAAAGG No data
1012846030_1012846033 14 Left 1012846030 6:104390003-104390025 CCCTACAGAATCCACTAAAAAAC No data
Right 1012846033 6:104390040-104390062 TAAAAATCCAGTAAAGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012846030 Original CRISPR GTTTTTTAGTGGATTCTGTA GGG (reversed) Intergenic
No off target data available for this crispr