ID: 1012846652

View in Genome Browser
Species Human (GRCh38)
Location 6:104397733-104397755
Sequence TGCAATTAGCACTGTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012846652_1012846653 2 Left 1012846652 6:104397733-104397755 CCAAGCTCACAGTGCTAATTGCA No data
Right 1012846653 6:104397758-104397780 ACAGTTAAGATCCCAACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012846652 Original CRISPR TGCAATTAGCACTGTGAGCT TGG (reversed) Intergenic
No off target data available for this crispr