ID: 1012852620

View in Genome Browser
Species Human (GRCh38)
Location 6:104465080-104465102
Sequence TGTGAGTTAGAGCTGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012852620_1012852622 1 Left 1012852620 6:104465080-104465102 CCTCTCAACAGCTCTAACTCACA No data
Right 1012852622 6:104465104-104465126 ATTTGAGAATAAGTGAGGAAAGG No data
1012852620_1012852623 2 Left 1012852620 6:104465080-104465102 CCTCTCAACAGCTCTAACTCACA No data
Right 1012852623 6:104465105-104465127 TTTGAGAATAAGTGAGGAAAGGG No data
1012852620_1012852624 3 Left 1012852620 6:104465080-104465102 CCTCTCAACAGCTCTAACTCACA No data
Right 1012852624 6:104465106-104465128 TTGAGAATAAGTGAGGAAAGGGG No data
1012852620_1012852621 -4 Left 1012852620 6:104465080-104465102 CCTCTCAACAGCTCTAACTCACA No data
Right 1012852621 6:104465099-104465121 CACAGATTTGAGAATAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012852620 Original CRISPR TGTGAGTTAGAGCTGTTGAG AGG (reversed) Intergenic
No off target data available for this crispr