ID: 1012854075

View in Genome Browser
Species Human (GRCh38)
Location 6:104480536-104480558
Sequence CTTTTTTTCTGCTAGTTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012854075_1012854076 -5 Left 1012854075 6:104480536-104480558 CCACTGAACTAGCAGAAAAAAAG No data
Right 1012854076 6:104480554-104480576 AAAAGCAAAGAAGAAATAGATGG No data
1012854075_1012854080 2 Left 1012854075 6:104480536-104480558 CCACTGAACTAGCAGAAAAAAAG No data
Right 1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG No data
1012854075_1012854079 1 Left 1012854075 6:104480536-104480558 CCACTGAACTAGCAGAAAAAAAG No data
Right 1012854079 6:104480560-104480582 AAAGAAGAAATAGATGGGGTCGG No data
1012854075_1012854078 -3 Left 1012854075 6:104480536-104480558 CCACTGAACTAGCAGAAAAAAAG No data
Right 1012854078 6:104480556-104480578 AAGCAAAGAAGAAATAGATGGGG No data
1012854075_1012854077 -4 Left 1012854075 6:104480536-104480558 CCACTGAACTAGCAGAAAAAAAG No data
Right 1012854077 6:104480555-104480577 AAAGCAAAGAAGAAATAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012854075 Original CRISPR CTTTTTTTCTGCTAGTTCAG TGG (reversed) Intergenic
No off target data available for this crispr