ID: 1012854080

View in Genome Browser
Species Human (GRCh38)
Location 6:104480561-104480583
Sequence AAGAAGAAATAGATGGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012854075_1012854080 2 Left 1012854075 6:104480536-104480558 CCACTGAACTAGCAGAAAAAAAG No data
Right 1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012854080 Original CRISPR AAGAAGAAATAGATGGGGTC GGG Intergenic
No off target data available for this crispr