ID: 1012858503

View in Genome Browser
Species Human (GRCh38)
Location 6:104530551-104530573
Sequence CCATTGCCCTAAAGAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012858503_1012858508 1 Left 1012858503 6:104530551-104530573 CCTATTTCTCTTTAGGGCAATGG No data
Right 1012858508 6:104530575-104530597 AATACCTATAGCAGAATAAGGGG No data
1012858503_1012858506 -1 Left 1012858503 6:104530551-104530573 CCTATTTCTCTTTAGGGCAATGG No data
Right 1012858506 6:104530573-104530595 GGAATACCTATAGCAGAATAAGG No data
1012858503_1012858507 0 Left 1012858503 6:104530551-104530573 CCTATTTCTCTTTAGGGCAATGG No data
Right 1012858507 6:104530574-104530596 GAATACCTATAGCAGAATAAGGG No data
1012858503_1012858511 5 Left 1012858503 6:104530551-104530573 CCTATTTCTCTTTAGGGCAATGG No data
Right 1012858511 6:104530579-104530601 CCTATAGCAGAATAAGGGGAGGG No data
1012858503_1012858509 4 Left 1012858503 6:104530551-104530573 CCTATTTCTCTTTAGGGCAATGG No data
Right 1012858509 6:104530578-104530600 ACCTATAGCAGAATAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012858503 Original CRISPR CCATTGCCCTAAAGAGAAAT AGG (reversed) Intergenic
No off target data available for this crispr