ID: 1012864264

View in Genome Browser
Species Human (GRCh38)
Location 6:104598621-104598643
Sequence AAGCTTTTCTATAGGACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012864264_1012864266 -5 Left 1012864264 6:104598621-104598643 CCATTGGTCCTATAGAAAAGCTT No data
Right 1012864266 6:104598639-104598661 AGCTTTTTAGTAATAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012864264 Original CRISPR AAGCTTTTCTATAGGACCAA TGG (reversed) Intergenic
No off target data available for this crispr