ID: 1012867501

View in Genome Browser
Species Human (GRCh38)
Location 6:104635402-104635424
Sequence TACACATGGATGATACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012867501_1012867506 6 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867506 6:104635431-104635453 TATGAATAGGGAAAACACTTTGG No data
1012867501_1012867504 -6 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867504 6:104635419-104635441 TGTGTATCATCCTATGAATAGGG No data
1012867501_1012867503 -7 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867503 6:104635418-104635440 ATGTGTATCATCCTATGAATAGG No data
1012867501_1012867510 19 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867510 6:104635444-104635466 AACACTTTGGGGTCCAGGCTAGG No data
1012867501_1012867508 8 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867508 6:104635433-104635455 TGAATAGGGAAAACACTTTGGGG No data
1012867501_1012867512 21 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867512 6:104635446-104635468 CACTTTGGGGTCCAGGCTAGGGG No data
1012867501_1012867513 27 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867513 6:104635452-104635474 GGGGTCCAGGCTAGGGGTGCTGG No data
1012867501_1012867509 14 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867509 6:104635439-104635461 GGGAAAACACTTTGGGGTCCAGG No data
1012867501_1012867511 20 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867511 6:104635445-104635467 ACACTTTGGGGTCCAGGCTAGGG No data
1012867501_1012867507 7 Left 1012867501 6:104635402-104635424 CCTGTCTGTATCATCCATGTGTA No data
Right 1012867507 6:104635432-104635454 ATGAATAGGGAAAACACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012867501 Original CRISPR TACACATGGATGATACAGAC AGG (reversed) Intergenic
No off target data available for this crispr