ID: 1012868039

View in Genome Browser
Species Human (GRCh38)
Location 6:104641415-104641437
Sequence GGAGACCAGCTAGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012868031_1012868039 13 Left 1012868031 6:104641379-104641401 CCTGGTGGACTGTGGAAGAAGAT No data
Right 1012868039 6:104641415-104641437 GGAGACCAGCTAGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012868039 Original CRISPR GGAGACCAGCTAGGAAACAC AGG Intergenic
No off target data available for this crispr