ID: 1012868571

View in Genome Browser
Species Human (GRCh38)
Location 6:104646319-104646341
Sequence TGTTTGGTGTGTTGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012868571_1012868575 4 Left 1012868571 6:104646319-104646341 CCACCTGGGCAACACACCAAACA No data
Right 1012868575 6:104646346-104646368 CCAGCTTTCATAGCTATCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012868571 Original CRISPR TGTTTGGTGTGTTGCCCAGG TGG (reversed) Intergenic
No off target data available for this crispr