ID: 1012875898

View in Genome Browser
Species Human (GRCh38)
Location 6:104725787-104725809
Sequence CTGTACCAATTTACAATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012875895_1012875898 -2 Left 1012875895 6:104725766-104725788 CCAAATTGCCTTCCAAAGAATCT No data
Right 1012875898 6:104725787-104725809 CTGTACCAATTTACAATCTAAGG No data
1012875896_1012875898 -10 Left 1012875896 6:104725774-104725796 CCTTCCAAAGAATCTGTACCAAT No data
Right 1012875898 6:104725787-104725809 CTGTACCAATTTACAATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012875898 Original CRISPR CTGTACCAATTTACAATCTA AGG Intergenic
No off target data available for this crispr