ID: 1012883347

View in Genome Browser
Species Human (GRCh38)
Location 6:104816817-104816839
Sequence CACAGGGGTGGAGCTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2591
Summary {0: 10, 1: 228, 2: 487, 3: 783, 4: 1083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012883339_1012883347 15 Left 1012883339 6:104816779-104816801 CCTGTGGAAGCAGTCTAGGGGGC 0: 1
1: 0
2: 2
3: 22
4: 143
Right 1012883347 6:104816817-104816839 CACAGGGGTGGAGCTACCCAAGG 0: 10
1: 228
2: 487
3: 783
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012883347 Original CRISPR CACAGGGGTGGAGCTACCCA AGG Intronic
Too many off-targets to display for this crispr